Feldarbeit, Laborarbeit und Literaturstudium


Das Institut für Insektenkunde im Ruhrgebiet e.V. ist ein gemeinnütziger Verein mit vielfältigen Aufgaben-und Arbeitsbereichen auf den Gebieten der wissenschaftlichen Entomologie und des praktischen Arten- und Naturschutzes. Getragen wird der Verein von ehrenamtlichen Mitarbeitern, die sich zumeist autodidaktisch und im Zuge vereinsinterner Fortbildungsveranstaltungen die notwendigen Kenntnisse angeeignet haben. Regelmäßige Treffen mit Vorträgen, mit Diskussionen aktueller Fragen, mit Erfahrungsaustausch und Planung gemeinsamer Aktivitäten fördern ein kontinuierliches Arbeiten, das sich unter anderem in zahlreichen Publikationen der Mitglieder und der Einbindung in überregionale Projekte niederschlägt.

 






Laborarbeit: Morphologische Untersuchungen sowie die Analyse von DNA-Sequenzen setzen wir für systematische Fragestellungen ein.
Entsprechende Präparationstechniken werden von verschiedenen Mitgliedern des Instituts beherrscht.

Untersuchungen der Morphologie von Schmetterlingen mit Hilfe mikroskopischer und mikrofotografischer Techniken dienen einerseits der Artenidentifizierung aber auch zur Merkmalanalyse für phylogenetische Fragestellungen.


Ein Neighbor-Joining tree, basierend auf einer Basensequenz des mitochondrialen COI_Gens von der Psychidae-Gattung Megalophanes. Aus dem Projekt "Psychidae of East- and South-Europe" in BOLD (Barcode of Life Databank).


Ausschnitt aus alinierten Basen-Sequenzen des mitochondrialen COI-Gens von Augenfalter-Arten

................GlyAsnProGlyPheLeu                     Asn

TATTCGAACAGAATTAGGAAACCCAGGATTTTTAATTGGAGATGATCAAATTTATAACAC   Mycalesis perseus
....................ACCCAGGATTTTTAATTGGAGATGACCAAATTTATAATAC
   Lohora unipupillata_KA197
.........AGAATTAGGTAACCCAGGATTTTTAATTGGAGATGAACAAATTTATAATAC   Lohora unipupillata_KA897

..........GAATTAGGTAACCCAGGATTTTTAATTGGAGATGACCAAATTTATAACAC   Lohora haasei_KA896

...................AACCCAAGATTTTTAATTGGAGATGACCAAATTTATAACAC   Lohora haasei_KA195

TATTCGTACAGAATTAGGTAATCCAGGATTTTTAATTGGAGATAATCAAATTTATAATAC   Lohora imitatrix_UK5-2

............ATTAGGTAACCCAGGATTTTTAATTGGGGATGACCAAATTTATAATAC   Lohora dexamenus_KA895

TATTCGTACAGAATTAGGTAACCCAGGATTTTTAATTGGAGATGACCAGATTTATAATAC   Lohora ophthalmicus_UK5-5

TATTCGTACAGAATTGGGTAACCCAGGATTTTTAATTGGCGATGACCAAATTTATAATAC   Lohora tanuki_UK5-7